Informasi

6.7: Gugus Gen RNA Ribosomal (rRNA) - Biologi

6.7: Gugus Gen RNA Ribosomal (rRNA) - Biologi


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Gambar di atas menunjukkan mikrograf elektron (26.500x) yang menunjukkan transkripsi pengkodean DNA RNA ribosom (rRNA) molekul dalam nukleolus sel telur berkembang dari kadal air yang terlihat.

Eukariota memiliki beberapa ratus gen identik yang mengkode RNA ribosom.

Filamen panjang (panah hijau) adalah molekul DNA yang dilapisi dengan protein. Serat memanjang dalam kelompok dari sumbu utama adalah molekul RNA ribosom yang akan digunakan dalam konstruksi ribosom sel.

Perhatikan bagaimana transkripsi dimulai pada salah satu ujung setiap gen, dengan molekul RNA semakin panjang (panah merah) saat mereka melanjutkan menuju penyelesaian.

Perhatikan juga jumlah besar (hingga 100) molekul RNA yang ditranskripsi serentak dari setiap gen.

Bagian-bagian dari DNA telanjang RNA tampaknya secara genetik tidak aktif. (Courtesy of O. L. Miller, Jr., dan Barbara R. Beatty, Divisi Biologi, Laboratorium Nasional Oak Ridge.)


RNA ribosom

Editor kami akan meninjau apa yang Anda kirimkan dan menentukan apakah artikel tersebut akan direvisi atau tidak.

RNA ribosom (rRNA), molekul dalam sel yang membentuk bagian dari organel sintesis protein yang dikenal sebagai ribosom dan yang diekspor ke sitoplasma untuk membantu menerjemahkan informasi dalam messenger RNA (mRNA) menjadi protein. Tiga jenis utama RNA yang terjadi dalam sel adalah rRNA, mRNA, dan RNA transfer (tRNA).

Molekul rRNA disintesis di daerah khusus inti sel yang disebut nukleolus, yang muncul sebagai daerah padat di dalam nukleus dan berisi gen yang mengkode rRNA. RRNA yang dikodekan berbeda dalam ukuran, dibedakan sebagai besar atau kecil. Setiap ribosom mengandung setidaknya satu rRNA besar dan setidaknya satu rRNA kecil. Dalam nukleolus, rRNA besar dan kecil bergabung dengan protein ribosom untuk membentuk subunit besar dan kecil ribosom (misalnya, 50S dan 30S, masing-masing, pada bakteri). (Subunit ini umumnya diberi nama sesuai dengan laju sedimentasinya, diukur dalam satuan Svedberg [S], dalam bidang sentrifugal.) Protein ribosom disintesis dalam sitoplasma dan diangkut ke nukleus untuk disusun dalam nukleolus. Subunit kemudian dikembalikan ke sitoplasma untuk perakitan akhir.

RRNA membentuk struktur sekunder yang luas dan berperan aktif dalam mengenali bagian mRNA dan tRNA yang terkonservasi. Dalam eukariota (organisme yang memiliki inti yang jelas), di mana saja dari 50 hingga 5.000 set gen rRNA dan sebanyak 10 juta ribosom dapat hadir dalam satu sel. Sebaliknya, prokariota (organisme yang tidak memiliki nukleus) umumnya memiliki lebih sedikit set gen rRNA dan ribosom per sel. Misalnya pada bakteri Escherichia coli, tujuh salinan gen rRNA mensintesis sekitar 15.000 ribosom per sel.

Ada perbedaan radikal antara prokariota dalam domain Archaea dan Bakteri. Perbedaan-perbedaan ini, selain terlihat dalam komposisi lipid, dinding sel, dan pemanfaatan jalur metabolisme yang berbeda, juga tercermin dalam urutan rRNA. rRNA Bakteri dan Archaea berbeda satu sama lain seperti halnya dari rRNA eukariotik. Informasi ini penting dalam memahami asal usul evolusi organisme ini, karena menunjukkan bahwa garis bakteri dan archaeal menyimpang dari prekursor umum sebelum sel eukariotik berkembang.

Pada bakteri, gen yang terbukti paling informatif untuk menyelidiki keterkaitan evolusioner adalah 16S rRNA, urutan DNA yang mengkodekan komponen RNA dari subunit yang lebih kecil dari ribosom bakteri. NS 16S rRNA gen hadir di semua bakteri, dan bentuk terkait terjadi di semua sel, termasuk sel eukariota. Analisis dari 16S rRNA urutan dari banyak organisme telah mengungkapkan bahwa beberapa bagian dari molekul mengalami perubahan genetik yang cepat, sehingga membedakan antara spesies yang berbeda dalam genus yang sama. Posisi lain berubah sangat lambat, memungkinkan tingkat taksonomi yang lebih luas untuk dibedakan.

Implikasi evolusioner lain dari rRNA berasal dari kemampuannya untuk mengkatalisis reaksi transferase peptidil selama sintesis protein. Katalis bersifat self-promoting—katalis memfasilitasi reaksi tanpa dikonsumsi sendiri. Dengan demikian, rRNA, yang berfungsi baik sebagai penyimpan asam nukleat maupun sebagai katalis, diduga memainkan peran kunci dalam evolusi awal kehidupan di Bumi.

Editor Encyclopaedia Britannica Artikel ini terakhir direvisi dan diperbarui oleh Kara Rogers, Editor Senior.


Abstrak

Spacer transkripsi internal dari cluster gen RNA ribosom nuklir, disebut ITS1 dan ITS2, adalah penanda nuklir yang paling sering digunakan untuk analisis filogenetik di banyak kelompok eukariotik termasuk sebagian besar keluarga tumbuhan. Alasan popularitas penanda ini meliputi: 1.) Kemudahan amplifikasi karena jumlah salinan yang tinggi dari kluster gen, 2.) Tersedia metode hemat biaya dan primer yang sangat lestari, 3.) Penanda yang berkembang pesat (yaitu variabel antara spesies terkait), dan 4.) Asumsi (dan/atau perlakuan) bahwa sekuens ini tidak berfungsi, penanda filogenetik yang berkembang secara netral. Di sini, analisis kami tentang ITS1 dan ITS2 untuk 50 spesies menunjukkan bahwa kedua sekuens tersebut malah berada di bawah batasan selektif untuk mempertahankan struktur sekunder yang tepat, kemungkinan untuk mempertahankan fungsi penyambungan diri yang lengkap, dan dengan demikian bukan penanda filogenetik yang berevolusi secara netral. Hasil kami menunjukkan sebagian besar situs urutan berevolusi bersama dengan posisi lain untuk membentuk struktur sekunder yang tepat, yang memiliki implikasi untuk inferensi filogenetik. Kami juga menemukan bahwa keadaan energi terendah dan jumlah total kemungkinan struktur sekunder alternatif sangat berbeda secara signifikan antara wilayah ITS dan urutan acak dengan panjang keseluruhan yang identik dan konten Guanine-Cytosine (GC). Terakhir, kami meninjau bukti terbaru yang menyoroti beberapa masalah bermasalah tambahan dengan menggunakan wilayah ini sebagai satu-satunya penanda untuk studi filogenetik, dan dengan demikian sangat merekomendasikan penanda tambahan dan pendekatan hemat biaya untuk studi masa depan untuk memperkirakan hubungan filogenetik.

Kutipan: Edger PP, Tang M, Bird KA, Mayfield DR, Conant G, Mummenhoff K, dkk. (2014) Analisis Struktur Sekunder dari Spacer Transkripsi Internal rRNA Nuklir dan Penilaian Utilitas Filogenetiknya di seluruh Brassicaceae (Mustards). PLoS ONE 9(7): e101341. https://doi.org/10.1371/journal.pone.0101341

Editor: Elvira Hörandl, Universitas Gottingen, Jerman

Diterima: 21 Agustus 2013 Diterima: 6 Juni 2014 Diterbitkan: 1 Juli 2014

Hak cipta: © 2014 Edger dkk. Ini adalah artikel akses terbuka yang didistribusikan di bawah persyaratan Lisensi Atribusi Creative Commons, yang mengizinkan penggunaan, distribusi, dan reproduksi tanpa batas dalam media apa pun, asalkan penulis dan sumber aslinya dicantumkan.

Pendanaan: PPE dan JCP mengakui dukungan dari Yayasan Sains Nasional AS (DEB 1146603, DBI 1110443, dan NPGI 1202793). M.A.K. mengakui pendanaan dari German Research Foundation (DFG) di bawah kode KO2302-11/1. 1. http://www.nsf.gov/ 2. http://www.dfg.de/en/. Para penyandang dana tidak memiliki peran dalam desain studi, pengumpulan dan analisis data, keputusan untuk menerbitkan, atau persiapan naskah.

Kepentingan bersaing: Para penulis telah menyatakan bahwa tidak ada kepentingan yang bersaing.


Analisis, optimalisasi, dan verifikasi survei amplikon gen 16S rRNA yang dihasilkan Illumina

Eksplorasi komunitas mikroba dengan mengurutkan gen 16S rRNA telah berkembang dengan instrumen sekuensing berbiaya rendah dan throughput tinggi. Sekuensing gen 16S rRNA berbasis Illumina baru-baru ini mendapatkan popularitas lebih dari 454 pyrosequencing karena biayanya yang lebih rendah, akurasi yang lebih tinggi, dan throughput yang lebih besar. Meskipun laporan terbaru menunjukkan bahwa Illumina dan 454 pyrosequencing memberikan ukuran keragaman beta yang serupa, masih harus ditunjukkan bahwa alur kerja 454 pyrosequencing yang sudah ada sebelumnya dapat mentransfer langsung dari 454 ke Illumina MiSeq sequencing hanya dengan mengubah adaptor pengurutan primer. Dalam penelitian ini, kami memodifikasi 454 primer pyrosequencing yang menargetkan daerah hiper-variabel V4-V5 dari gen 16S rRNA agar kompatibel dengan sekuenser Illumina. Komunitas mikroba dari sapi, manusia, lintah, tikus, kotoran, dan rayap dan komunitas tiruan dianalisis dengan 454 dan pengurutan MiSeq dari wilayah V4-V5 dan pengurutan MiSeq dari wilayah V4. Analisis kami mengungkapkan bahwa pengelompokan OTU berbasis referensi saja menimbulkan bias dibandingkan dengan pengelompokan de novo, mencegah taksa tertentu diamati dalam beberapa sampel. Berdasarkan ini, kami merancang dan merekomendasikan saluran analisis yang mencakup penggabungan baca, penyaringan kontaminan, dan pengelompokan berbasis referensi diikuti oleh pengelompokan OTU de novo, yang menghasilkan ukuran keragaman yang konsisten dengan analisis pengelompokan OTU de novo. Kontaminasi set data tingkat rendah dengan pengurutan Illumina ditemukan yang dapat memengaruhi analisis yang memerlukan pendekatan yang sangat sensitif. Sementara pindah ke platform pengurutan berbasis Illumina menjanjikan untuk memberikan wawasan yang lebih dalam tentang luas dan fungsi keanekaragaman mikroba, hasil kami menunjukkan bahwa perawatan harus dilakukan untuk memastikan bahwa pengurutan dan pemrosesan artefak tidak mengaburkan keanekaragaman mikroba yang sebenarnya.

Pernyataan konflik kepentingan

Kepentingan yang Bersaing: Para penulis menyatakan bahwa tidak ada kepentingan yang bersaing.

Angka

Gambar 1. Perbandingan 454 dan Illumina…

Gambar 1. Perbandingan 454 dan kualitas urutan Illumina.

Plot yang menggambarkan median per basis…

Gambar 2. Metode pemrosesan RDS mereplikasi…

Gambar 2. Replikasi metode pemrosesan RDS de novo Pengelompokan OTU lebih baik daripada pengelompokan berbasis referensi.

Gambar 3. Analisis keragaman beta dari semua…

Gambar 3. Analisis keragaman beta dari semua dataset.

Plot analisis koordinat utama tiga dimensi menunjukkan…

Gambar 4. Pengaruh metode pengolahan terhadap…

Gambar 4. Pengaruh metode pemrosesan pada komposisi taksonomi dari kumpulan data komunitas tiruan.

Gambar 5. Pengaruh metode pengolahan dan…

Gambar 5. Pengaruh metode pemrosesan dan versi database Greengenes terhadap komposisi taksonomi…


Kuda Theileria jenis

NS 18S sekuens gen RNA ribosomal dari equid-infective Theileria spesies terpisah menjadi lima clades (Gbr. 1), yang dibahas secara rinci nanti dalam ulasan ini. Untuk tujuan ulasan ini, parasit dalam rDNA clade A terdiri dari: T. equi (sensu ketat) yang dicirikan paling baik dalam hal biologi dan kepentingan ekonomi, sedangkan yang berada di clades B–E, (termasuk T. haneyi di clade C) ditunjuk T. equi (sensu lato).

18S urutan rDNA ditempatkan di GenBank dan diidentifikasi sebagai: Theileria equi tetapi terdeteksi dalam berbagai spesies inang dikumpulkan dan disejajarkan di CLC Genomics Workbench v.10.1.1 (Qiagen), bersama dengan outgroup 18S urutan rDNA dari piroplasmid lain seperti yang diidentifikasi pada gambar. Semua sekuens dipangkas dengan panjang yang identik 401 bp, dan menjangkau wilayah hipervariabel ke-4 dari panjang penuh 18S rDNA. Urutan yang disejajarkan dibandingkan dalam filogeni kemungkinan maksimum dalam program yang sama, dengan model substitusi nukleotida Kimura 80, dengan penggabungan tetangga yang digunakan dalam membangun pohon awal untuk memungkinkan inferensi evolusioner yang ditingkatkan. Lima ratus ulangan dilakukan dalam analisis bootstrap dengan nilai untuk simpul di atas batas 50 yang ditunjukkan pada pohon untuk cabang utama. Pohon tersebut memberikan sampel representatif dari urutan ribosom yang jatuh ke dalam clades berbeda di berbagai spesies inang yang terinfeksi dan tidak dimaksudkan untuk memberikan gambaran lengkap tentang hubungan semua equid. Theileria mengisolasi

Studi genomik komparatif [12, 21] menunjukkan bahwa T. equi dan T. haneyi memiliki fitur perantara antara Theileria dan Babesia dan mungkin mewakili takson yang berbeda, lebih dekat ke Theileria dibandingkan Babesia. Mirip dengan yang lainnya Theileria sp., T. equi mengalami skizogoni pada leukosit sebelum perkembangan tahap intraeritrositik [22], tidak seperti Babesia spp., yang hanya menginfeksi eritrosit mamalia. Tahap siklus hidup intraleukosit belum terbukti T. haneyi, dan penelitian sedang dilakukan untuk menentukan apakah ada.

Analisis ultrastruktural dari Theileria sp. yang sejauh ini telah dipelajari menunjukkan bahwa masuknya sel mamalia melibatkan 'ritsleting' dari parasit dan membran inang yang berdekatan, tetapi tidak memerlukan pengikatan kompleks apikal yang bergantung pada orientasi dan pelepasan isi organel, seperti pada Babesia sp. dan spesies sebagian besar genera apicomplexan lainnya [6, 7]. Selanjutnya, di Theileria, rhoptries dan organel apikal lainnya terlibat dalam pembentukan di dalam sel inang, tetapi tidak dalam proses masuk seperti di sebagian besar Apicomplexa. Peran organel kompleks apikal dalam T. equi dan T. haneyi entri sel inang saat ini tidak diketahui, tidak seperti T. parva dan T. annulata, T. equi sporozoit dan merozoit memiliki struktur morfologi yang mirip dengan mikronema [23] dan karena itu dapat menggunakan mekanisme invasi sel inang yang berbeda. Salah satu mekanisme penting dari kekebalan protektif terhadap transformasi Theileria, termasuk T. parva, tergantung baik pada perkembangan respons sel T CD8+ terhadap leukosit inang yang terinfeksi skizon dan respons antibodi terhadap antigen sporozoit [24, 25]. Sementara non-transformasi Theileria juga memiliki periode singkat skizogoni pada leukosit inang [22], keberadaan dan signifikansi respon imun yang dimediasi sel terhadap tahap parasit ini tetap tidak dikarakterisasi. Berbeda dengan transformasi yang lebih terkenal Theileria spesies, tetapi mirip dengan Babesia, transmisi T. equi pada kutu terjadi baik secara transtadial maupun intrastadial [1].

Berbeda dengan lainnya Theileria, T. persamaan-parasit jenis menginfeksi beberapa keluarga mamalia, dengan laporan infeksi pada anjing [26, 27], unta [28], tapir [29], waterbuck, sapi, kambing [30], dan domba [31] selain equids. Penyakit klinis telah diamati pada tapir dan anjing, tetapi tidak pada unta. Sebagian besar transformasi dan non-transformasi lainnya Theileria spesies parasit hanya satu keluarga mamalia dan sering hanya satu sampai tiga spesies dalam keluarga itu [32]. Theileria equi juga promiscuous dalam kisaran vektor kutu ixodid yang digunakan, dengan setidaknya 14 spesies kutu yang berbeda secara filogenetik dalam empat genera berbeda yang terlibat dalam transmisi alami dan eksperimental [2]. Kemampuan untuk bertahan hidup di banyak spesies mamalia dan vektor arthropoda mungkin merupakan konsekuensi dari komplemen gen yang lebih besar di T. equi, yang 11,7 megabase (Mb) genomnya mengandung 1985 gen penyandi protein yang diprediksi yang tidak ada di Babesia bovis dan transformasi sel inang Theileria spesies [12]. Theileria haneyi memiliki genom sekitar 10 Mb, berukuran sedang antara transformasi sel inang Theileria dan T. ekui. Spesies ini memiliki minimal 878 gen yang tidak ada di T. parva dan T. annulata [33].

Fitur baru dari T. equi genom termasuk ekspansi besar dari keluarga protein transporter kaset pengikat ATP multikopi dan keluarga protein sekretori tipe II [21], yang dapat berkontribusi pada kemampuan parasit untuk bertahan hidup di beberapa host dan jaringan vektor. Banyak gen tambahan dalam T. equi dan T. haneyi terletak di keluarga gen multicopy paralogous yang tidak menunjukkan identitas urutan yang signifikan untuk protein dalam database publik, meskipun beberapa mengandung domain yang dilestarikan. Oleh karena itu, pemahaman yang lebih baik tentang dasar molekuler dari inang bebas dan preferensi vektor menunggu sistem untuk manipulasi genetik dan fenotip parasit ini. Equid infektif Theileria sp. memiliki FAINT (sering dikaitkan dengan Theileria) domain dalam beberapa kerangka baca terbuka (ORFS). Domain FAINT, yang fungsinya tidak diketahui, hadir dalam proteom virtual dari T. parva, T annulata dan T. orientalis, tetapi tidak ada dalam Babesia spesies [34, 35].


2. Fragmen RNA ribosom (rRFs)

rRNA-derived fragments (rRFs) adalah RNA non-coding pendek (ncRNAs) yang diturunkan dari rRNA nuklir dan mitokondria 22 . Fragmen-fragmen ini seringkali berlimpah dan terbukti termodulasi baik dalam jenis kelamin maupun populasi.

Next generation sequencing (NGS) adalah alat yang ampuh untuk penemuan RNA dan memungkinkan para ilmuwan untuk membuat katalog RNA dalam sel kita dengan cara yang tidak bias. Banyak RNA panjang dan pendek yang penting telah ditemukan dan dicirikan dalam konteks kesehatan dan penyakit. Telah diketahui selama beberapa tahun bahwa RNA noncoding kecil (sncRNAs) seperti microRNAs (miRNAs), miRNA isoform (isomiRs), dan tRNA-derived fragments (tRFs) memiliki peran fungsional dalam regulasi ekspresi gen. Lab Rigoutsos menunjukkan bahwa baik miRNA maupun tRNA memproduksi secara teratur “awan” dari isomiRs 15 dan tRFs 16 yang ada bersama-sama. IsomiR dan tRF dari templat induk yang sama biasanya berbagi urutan inti yang sama dan berbeda dalam titik akhirnya. Lab Rigoutsos juga menunjukkan bahwa identitas dan kelimpahan isomiR dan tRF bergantung pada atribut pribadi seperti jenis kelamin, asal populasi, dan ras/etnis serta pada jenis jaringan, keadaan jaringan, dan jenis penyakit 17󈞁 .

Sebuah publikasi terbaru dari lab Rigoutsos mengkarakterisasi rRF yang dihasilkan dari enam rRNA (Gambar 2) 22 . Mereka menganalisis profil sncRNA dari garis sel limfoblastoid yang berasal dari 434 peserta Proyek 1000 Genom. Para peserta terdiri dari pria dan wanita sehat dari lima populasi geografis. Itu adalah tujuan kami untuk memahami profil rRF universal dan spesifik populasi. Kami menunjukkan bahwa rRNA menghasilkan “awan” rRFs secara teratur. Kami juga menunjukkan bahwa ada ribuan rRF yang dihasilkan dari lokasi tertentu di keenam rRNA. RRF ini memiliki profil panjang dan kelimpahan yang unik. Analisis kami menunjukkan bahwa banyak dari rRF ini ada di mana-mana dan ada di semua sampel yang dianalisis. Namun, kami juga menemukan sejumlah besar rRF yang bergantung pada atribut pribadi donor termasuk jenis kelamin dan asal populasi, serta pada jenis jaringan dan penyakit. Properti ini mencerminkan temuan lab sebelumnya tentang isomiR dan tRF.

Gambar 2: Empat rRNA nuklir dan dua mitokondria menghasilkan banyak fragmen (rRF) dengan cara yang teratur

rRFs adalah tambahan terbaru untuk repertoar sncRNA. Mereka mewakili kelas ketiga sncRNA yang produksinya bergantung pada atribut pribadi dan konteks seluler. Cara di mana rRF diproduksi tidak diketahui. Juga tidak diketahui mekanisme aksi dan peran fungsional rRFs’. Pertanyaan-pertanyaan ini saat ini menjadi area penyelidikan aktif oleh para peneliti di Pusat Pengobatan Komputasi Jefferson.


Bahan dan metode

Strain ragi, plasmid, kondisi pertumbuhan untuk amplifikasi hiper

Strain ragi yang digunakan dalam penelitian ini berasal dari NOY408-1b di latar belakang genetik W303 dan dari strain S288c (OpenBiosystems) dan tercantum dalam Tabel S1. Strain ditanam pada 30 ° C dalam media YPD kecuali untuk hst3 hst4 mutan ganda yang dikultur pada 23°C. Untuk memantau hiper-amplifikasi rDNA, rtt109 mutan dengan plasmid yang mengandung galaktosa-inducible FOB1 (YCplace22-Gal-FOB1) diprakultur dalam medium sintetik lengkap dikurangi triptofan dengan rafinosa (SC-trp+raf). Strain kemudian dipindahkan ke SC-trp dengan galaktosa bukan rafinosa (pada waktu nol) dan dipanen pada waktu yang ditunjukkan (0, 6, 12, 18, 24, 36 jam) untuk menyiapkan DNA genom dalam sumbat agrose [43]. Sebagai kontrol, RTT109 regangan dipantau secara paralel. Raffinose (1/10 volume stok raffinose 10X) dan galaktosa ditambahkan sesaat sebelum digunakan. Strain ragi dengan substitusi asam amino pada histone K56 dihasilkan oleh pengocokan plasmid [44].

Skrining luas genom untuk mutan ragi dengan nomor salinan rDNA tinggi

DNA genom dimurnikan dari 4.800 mutan ragi dari perpustakaan penghapusan genom (OpenBiosystems) seperti yang dijelaskan [43]. Mereka kemudian menjadi sasaran elektroforesis gel bidang berdenyut seperti yang dijelaskan di bawah ini. Gel diwarnai dengan etidium bromida (EtBr). Strain mutan dengan kromosom XII lebih panjang dari penanda ukuran 3,13 Mb (H. wingei) diklasifikasikan sebagai mutan rDNA hiper-amplifikasi (Tabel 1). Kami menggunakan gel lebar dengan sisir panjang (45 gigi) untuk melakukan elektroforesis. Tiga gel tipis ditumpuk satu sama lain dalam tangki elektroforesis yang memungkinkan berjalannya 130 sampel secara simultan.

Elektroforesis gel medan-pulsa dan hibridisasi Selatan

Elektroforesis gel bidang berdenyut (CHEF) menggunakan CHEF Mapper XA (BioRad) dan hibridisasi Selatan dilakukan seperti yang dijelaskan [25], [43]. Kondisinya adalah waktu pulsa 300-900 detik dan 100 V selama 68 jam pada 14°C dalam gel agarosa 0,8%.

Elektroforesis gel 2D

Untuk mendeteksi intermediet replikasi dan rekombinasi dengan elektroforesis gel 2D selama hiper-amplifikasi, DNA dibuat dari sel (YSI204, YSI205) yang tumbuh di SC-trp+Gal (9 jam) dan SC-trp+Raf, dan dicerna dengan tidakI dalam sumbat agarosa [43]. rDNA terdeteksi dengan probe spesifik rDNA. DNA diisolasi dan dicerna dalam sumbat agarosa.

Untuk mendeteksi ERC selama hiper-amplifikasi dengan elektroforesis gel 2D, DNA diisolasi dari sel sebelum dan 9 jam setelah dilepaskan ke SC-trp +Gal. Untuk memisahkan DNA besar antara 5 dan 50 kb dengan elektroforesis gel 1D, gel SeaKem Gold Agarose (Lonza) 0,3% digunakan dalam TAE pada 1 V/cm selama 20 jam. Setelah mengeluarkan setiap jalur di atas 5 kb dari gel 1D, elektroforesis gel 2D dilakukan dalam 1,0% SeaKem LE Agarose gel (Lonza) dengan EtBr pada 6 V/cm selama 5 jam pada 4°C. Gel dihilangkan dan bagian dari membran yang mengandung DNA lebih panjang dari 7 kb dihibridisasi dengan probe spesifik rDNA. Bagian lain dari membran yang mengandung DNA yang lebih pendek dari 7 kb diperiksa dengan URA3. Sinyal ERC dinormalisasi menjadi URA3 sinyal di setiap blot. Jumlah relatif ERC ditentukan dari tiga percobaan independen seperti yang ditunjukkan pada Gambar 8B. Untuk mendeteksi amplifikasi lingkaran bergulir (Gambar 8D) dengan elektroforesis gel 2D, sel-sel dengan plasmid IGS, YEplac195 yang mengandung wilayah IGS dari rDNA digunakan. DNA diisolasi dari sel 48 jam setelah dilepaskan ke SC-trp +Gal. Kondisi yang digunakan untuk elektroforesis gel 2D dan induksi hiper-amplifikasi serupa dengan yang dijelaskan di atas, kecuali bahwa DNA dicerna dengan BglII sebelum elektroforesis. BglII tidak memotong plasmid tetapi memotong rDNA kromosom, sehingga hanya plasmid yang terintegrasi pada kromosom yang membentuk struktur linier mengikuti BglII pencernaan. Urutan plasmid dideteksi menggunakan probe spesifik (amp).

Imunopresipitasi kromatin

Imunopresipitasi kromatin dilakukan seperti yang dijelaskan [6].

Mikroskop kekuatan atom (AFM)

Fraksi DNA yang tersisa dalam sumbat gel agrose setelah elektroforesis gel medan-pulsa diekstraksi dengan penghancuran. Pengamatan AFM dilakukan seperti yang dijelaskan [45]. Selama preparasi sampel, DNA dipotong menjadi fragmen yang lebih kecil (<∼50 kb). Di antara pecahan-pecahan ini (∼1.500), kami mencari lingkaran dengan ukuran yang tepat (8–11 kb). Pencitraan dilakukan dengan AFM MultiMode Instrumen Didital dalam mode penyadapan. Gambar J (NIH) digunakan untuk pengukuran panjang DNA.


Identifikasi situs yang diperlukan untuk aktivitas pemblokiran garpu replikasi DNA di kluster gen rRNA di Saccharomyces cerevisiae

Genom ragi memiliki situs pemblokiran garpu replikasi DNA, yang kami beri nama sedih situs, dalam kluster gen RNA ribosom (rDNA). Ini terletak di ujung 3' unit transkripsi rRNA 35S dan mereka memblokir gerakan garpu replikasi ke arah yang berlawanan dengan RNA polimerase I. Kami mengkloning situs pemblokiran replikasi ini menjadi plasmid tipe YEp dan menganalisis intermediet replikasi DNA, menggunakan elektroforesis gel agarosa dua dimensi (2D). Aktivitas pemblokiran tetap bahkan pada plasmid yang tidak terlibat dalam transkripsi 35S rRNA dan menghambat gerakan garpu dengan cara kutub yang sama seperti pada kromosom ragi. Untuk menentukan situs lebih lanjut, fragmen yang lebih kecil disubklon ke dalam plasmid tipe YEp. 109 kecil berdasarkan wilayah dipamerkan sedih aktivitas dan terletak di dekat wilayah penambah untuk transkripsi 35S rRNA. Ini tumpang tindih dengan elemen penting dari hot spot rekombinasi PANAS1.

Ini adalah pratinjau konten langganan, akses melalui institusi Anda.


Hasil

Analisis sitogenetik

Data sitogenetik dasar, termasuk nomor diploid dan morfologi kromosom dari spesies yang dianalisis, konsisten dengan informasi yang dipublikasikan sebelumnya [24, untuk ditinjau]. Peta sitogenetik 5S rDNA diperoleh untuk 18 spesies cichlid Amerika Selatan, 22 Afrika, dan satu Asia, dan data disajikan dalam File tambahan 1 dan 2. Diambil bersama dengan informasi sitogenetik yang diterbitkan sebelumnya untuk famili ini, jumlah spesies yang diselidiki sejauh ini telah diperbarui menjadi 23 Afrika, 1 Asiatik, dan 23 Neotropis (lihat File tambahan 1 dan 2). Kromosom metafasik hibridisasi representatif ditunjukkan pada Gambar 1 dan 2. Jumlah situs per genom diploid berkisar antara 2 hingga 15, dengan pola yang paling umum adalah adanya 2 kromosom yang mengandung gugus 5S rDNA. Pola ini terjadi pada 38 spesies, yang berhubungan dengan

79,0% dari sampel yang dianalisis. Jumlah situs tertinggi diamati pada spesies Afrika Astatotilapia latifasciata (15 situs, Gambar 1g) dan dalam spesies Neotropis Laetacara dorsigera (14 situs, Gambar 2g). Kedua spesies ini dikeluarkan dari analisis statistik yang disajikan di bawah ini karena jumlah kluster 5S rDNA yang sangat besar dibandingkan dengan spesies cichlid lain yang dipelajari.

Fluoresensi di tempat hibridisasi urutan 5S rDNA ke kromosom metafasik cichlid Asia dan Afrika. Urutan 5S rDNA dideteksi dengan FITC (hijau), kromosom dilawan dengan DAPI, dan gambar diubah menjadi skala abu-abu. (A) Etroplus maculatus, (B) Oreochromis niloticus, (C) Tilapia maria, (D) T. mamfe, (e) Hemikromis bimaculatus, (F) Gephyrochromis moorii, (G) Astatotilapia latifasciata, (H) Melanokromis auratus, (Saya) Pseudotropheus tropheus. Panah menunjukkan kromosom pembawa rDNA 5S. Batang = 5 m.

Fluoresensi di tempat hibridisasi urutan 5S rDNA ke kromosom metafasik dari cichlids Neotropis. Urutan 5S rDNA dideteksi dengan FITC (hijau), kromosom dilawan dengan DAPI, dan gambar diubah menjadi skala abu-abu. (A) Retroculus lapidifer, (B) Astronotus ocellatus, (C) Cichla piquiti, (D) Proksimus geofagus, (e) jurupari satanoperca, (F) Aequidens tetramerus, (G) Laetacara dorsigera, (H) Pahlawan efasciatus, (Saya) Mesonauta festivus. Panah menunjukkan kromosom yang mengandung 5S rDNA, dan tanda bintang menandai kromosom yang mengandung dua tempat. Batang = 5 m.

Data saat ini dan hasil yang dipublikasikan sebelumnya mengungkapkan rata-rata 2,7 situs 5S rDNA per genom, di mana

31,7% terletak di kromosom meta/submetasentrik (m/sm) dan

68,3% berada dalam kromosom telo/akrosentrik (t/a). Berkenaan dengan posisi kromosom dari situs-situs ini,

42,9% memiliki lokasi proksimal (p),

47,6% memiliki lokasi interstisial (i), dan

9,5% memiliki lokasi terminal (t). Saat memeriksa lokasi 5S rDNA pada lengan kromosom, kami menemukan bahwa

50,8% situs dikaitkan dengan lengan panjang (L) dan

12,7% dikaitkan dengan lengan pendek (S). Tambahan,

36,5% dipetakan secara dekat ke wilayah sentromer (C), tetapi tidak mungkin untuk membedakan lengan kromosom di mana mereka diposisikan (lihat File tambahan 1 dan 2 Tabel 1 Gambar 3).

Distribusi jumlah dan persentase kluster rDNA 5S (batang hijau) dan 18S (batang merah) di masing-masing 48 dan 41 genom cichlid. Spesies dengan kondisi polimorfik dianggap lebih dari satu kali. (A) Jumlah total situs, (B) jumlah/persentase situs dalam kromosom dengan morfologi yang berbeda: telo/akrosentrik (t/a), meta/submetasentrik (m/sm) (C) jumlah/persentase situs proksimal (p), interstisial (i) dan terminal (t) (D) distribusi jumlah/persentase situs di lengan kromosom yang berbeda: pendek (S), panjang (L), dan di daerah sentromer (C). Spesies Astatotilapia latifasciata dan Laetacara dorsigera dikeluarkan karena jumlah atipikal kluster 5S rDNA mereka.

Tiga spesies Afrika diselidiki untuk pemetaan rDNA 18S mereka (Ikan nila mamfe, Placidochromis electra dan Zebra semu) dalam penelitian ini, yang memperbarui total spesies cichlid yang dianalisis menjadi 32 (File tambahan 1 dan 2). Jumlah situs 18S rDNA bervariasi dari 2 hingga 6, rata-rata

2,9 situs per genom diploid. Kondisi modal adalah adanya 2 situs pada satu pasangan kromosom homolog (

63,4%). Sebagian besar kluster gen 18S rRNA (

68,3%) ditemukan pada kromosom t/a, dan

31,7% terletak di elemen m/sm. 18S rDNA hadir di lokasi terminal di

93,3% dari situs yang dipetakan saja

6,6% adalah interstisial, dan tidak ada yang hadir di wilayah proksimal. Karakteristik luar biasa lainnya adalah asosiasi 18S rDNA dengan lengan pendek kromosom (

2,5% dari situs terletak di lengan panjang, dan tidak ada yang terkait dengan daerah sentromer (lihat File tambahan 1 dan 2 Tabel 2 Gambar 3).

Analisis individu dari data untuk dua kelompok besar yang diteliti, cichlid Afrika dan Neotropis, mengungkapkan karakteristik khusus untuk masing-masing kelompok (lihat File tambahan 1 dan 2 Tabel 1). Untuk rDNA 5S, karakteristiknya adalah sebagai berikut: jumlah rata-rata situs per genom diploid adalah 3,1 dan 2,3 situs di perwakilan Afrika dan Neotropis, masing-masing 56,8% situs terletak di kromosom t/a, dan 43,2% situs berada terletak di kromosom m/sm di garis keturunan Afrika 84% dari situs terletak di t/a kromosom, dan 16% dari situs di m/sm kromosom di cichlids Neotropis lokasi preferensial situs adalah proksimal (67,6%) di Afrika dan interstisial di cichlids Neotropis (76,0%) di Afrika, sebagian besar situs dipetakan secara dekat ke wilayah sentromer (71,9%), sedangkan untuk Neotropis, rDNA 5S sebagian besar dipetakan ke lengan kromosom panjang (84,0%). Untuk rDNA 18S, karakteristiknya adalah sebagai berikut: jumlah rata-rata situs per genom diploid adalah 3,7 dan 2,5 situs di perwakilan Afrika dan Neotropis, masing-masing semua situs yang diamati untuk 18S rDNA di cichlid Afrika terletak di terminal daerah lengan pendek kromosom t/a (lihat File tambahan 1 Tabel 2) pada spesies Neotropis, pola yang lebih bervariasi untuk posisi penanda ini diamati dengan lokasi di kromosom m/sm dan t/a yang tepat lokasinya terutama di daerah terminal lengan pendek (lihat File tambahan 2 Tabel 2).

Selain perbedaan umum antara dua garis keturunan cichlid, pada spesies Afrika, variasi distribusi 5S rDNA diamati di antara ikan nila dan haplochromine. Pada ikan nila (Gambar 1b-d), situs 5S rDNA umumnya terletak pada kromosom t/a kecil. Dalam haplochromines (Gambar 1f-i), salinan gen ini terletak pada pasangan kromosom m/sm terbesar di semua spesies yang dianalisis (lihat File tambahan 1 Tabel 2) dengan situs tambahan yang diamati pada Astatotilapia latifasciata (Gambar 1g) dan Gephyrochromis moorii (Gambar 1f). Pandangan sintetis dari kemungkinan jumlah modal dan lokasi kromosom untuk kluster rDNA 5S dan 18S dalam garis keturunan cichlid yang berbeda ditunjukkan pada Gambar 4.

Tampilan sintetis dari lokasi kromosom rDNA yang paling sering diplot pada kladogram keluarga cichlid. Pohon itu didasarkan pada filogeni yang diusulkan oleh Sparks dan Smith (2004).

Analisis gen rRNA 5S dan 18S dalam genom O. niloticus

Hasil pencarian gen 5S rRNA BLASTn dari database BouillaBase diperoleh 59 eksemplar yang terdistribusi pada 42 scaffold, dan pencarian gen 18S rRNA didapatkan 38 eksemplar yang terdistribusi pada 31 scaffolds (lihat File tambahan 3). Untuk setiap hasil, salinan diduga diberi peringkat menurut panjang urutan dan nilai-E. Scaffold 6 adalah satu-satunya yang menyimpan salinan gen 5S dan 18S rRNA diduga (Gambar 5). Sebagian besar sekuens rRNA 18S yang dipulihkan adalah salinan sebagian dari gen (lihat File tambahan 4). Meskipun penelitian sebelumnya mendeteksi dua jenis pengulangan 5S rDNA (tipe I dan tipe II) di O. niloticus genome [25], only type I copies were recovered in the present analysis (see Additional file 5). Moreover, the analysis of the FRs of the rRNA genes (see Additional files 6 and 7) detected the presence of transposable elements (TEs) that flanked a high number of rRNA gene copies, with a predominance of SINEs in the FRs of 5S rRNA gene sequences (Figure 5).

The organization of rRNA genes and TEs on scaffold 6 of the Oreochromis niloticus genome. The 5S and 18S rRNA genes, putative TEs (SINE2-1_AFC, PIVE, Copia-53_MLp-1 and SINE_FR2), and the vasa gene are indicated by arrows. C1 and C2 represent conserved repeats in the NTS of the 5S rRNA type I gene.


Sandwalk

Humans 5S RNA genes are about 200 bp in size from the transcription start site to the termination site. The precursor is processed to give the mature 120 bp 5S RNA that is incorporated into ribosomes [Ribosomal RNA Genes in Eukaryotes].

5S RNA genes are arranged as tandem repeats in a large cluster on chromosome 1 (1q42). The number of repeats varies from individual to individual within the range of 35-175 copies (Stults et al. 2008). The length of the repeats also varies but most of the genes are part of a 2200 bp repeat. Since only a small part of this is actually transcribed (200 bp) it looks like much of this locus is non-essential DNA. (The 5S RNA repeat in macaques is 7300 bp and in rats it is 1800 bp.)

The reported human genome sequences do not contain the region of the 5S RNA genes. It is impossible to clone and assemble fragments of repeated DNA sequences.

The other ribosomal RNA genes are located in a single transcription unit that gives rise to an RNA precursor of 13,000 bp. This is known as 45 RNA and the "gene" (operon) is often called the 45S gene. This large transcript is processed to give three mature RNAs: 18S (1874 bp), 5.8S (160 bp), and 28S (4718 bp) [Ribosomal RNA Genes in Eukaryotes].

The transcription units are arranged mostly as head-to-tail tandem repeats of 43 kb. Thus, 30 kB of this repeat unit consists of non-transcribed spacer. The length of this non-transcribed spacer varies from species to species although it tends to be the same within a given species (but see below). The conservation of length and sequence in a region of DNA that is non-essential may seem surprising but it is related to the frequent recombination events that occur at the sites of ribosomal RNA genes. The genes themselves are almost identical in sequence as a result of concerted evolution or gene conversion. The flanking regions (non-transccribed spacers) are "conserved" because they are carried along.

Let's assume that 20 kb of the non-transcribed spacer is non-functional and non-essential (= junk). That means 23 kb (13 kb of 45S transcript and 10 kb of spacer) is essential for proper function of the ribosomal RNA genes.

The ribosomal RNA genes are located at regions called nucleolar organizer regions (NORs) because this is the site where a nucleolus forms within the nucleus. The nucleolus is actually a dense region of the nucleus where massive transcripton of ribosomal RNA genes is occurring.

In humans, there are five clusters of ribosomal RNA genes (NORs) located at 13p12, 14p12, 15p12, 21p12, and 22p12. All of them are found in distinctive regions at the ends of apocentric chromosomes (chromosomes with a centromere region near one end). Cluster lengths (number of repeats) varies from individual to individual. The frequency of recombination events leading to rearrangements is

10% per generation. This means that almost every individual has a unique fingerprint of ribosomal RNA gene repeats. (Each of us has 10 clusters.)

There are about 600 repeats in the average diploid genome (Stults, 2008). (This means 300 repeats in the haploid genome.) As is the case with the 5S repeats, none of the nucleolar organizer regions has been cloned and sequenced. All five loci are represented by large gaps in the "finished" genome.

The total amount of DNA in the large ribosomal RNA clusters is 12,900 kb (300 × 43 kb). Of this amount 6,000 kb (47 %) is probably junk in the sense that it is dispensible.

Many of the human 45S genes are pseudogenes and unusual rearrangements are common (Caburet et al., 2005). In mouse, up to half of all the 45S genes are non-functional pseudogenes. Presumably these are due to errors in recombination events and they are likely to be transient.

The minimum number of 45S genes in mammals is not known for certain in humans but in chickens the loss of anything more than half the average number is lethal. It seems reasonable that of the 300 or so human 45S genes only about 150 are absolutely required and the remainder are dispensable. However, concerted evolution of these genes is essential in the long run and the mechanism of concerted evolution and gene conversion requires lots of copies. Thus, all copies are necessary for the species even though only half may be required for any one individual.

Total ribosomal RNA genes in the genome:

5S: 100 copies of 2.2 kb repeats = 220 kb. (estimate 100 kb essential, 120 kb junk)
45S: 300 copies of 43 kb repeats = 12,900 kb. (estimate 7,000 kb essential, 6,120 junk)


Dataset: 1000 Genomes Project

We used the short RNA-seq datasets that were released by the 1KG Project [32] and were derived from the lymphoblastoid cell lines (LCL) of individuals belonging to five population groups: CEU (Utah Residents with Northern and Western European Ancestry), FIN (Finnish in Finland), GBR (British from England and Scotland), TSI (Toscani in Italia), and YRI (Yoruba in Ibadan, Nigeria). The 1KG Project released 452 total short RNA-sequencing datasets (and 35 technical replicates). The samples were sequenced at seven facilities (Geuvadis Consortium). The 48 samples that were sent to one of the facilities (number “six”) were sequenced using 47 cycles of sequencing whereas all other samples were sequenced using 33 cycles. In order to be consistent, we removed all samples that came from facility “six”—this left us with 434 LCL datasets for our downstream analyses (83 CEU, 94 FIN, 88 GBR, 87 TSI, and 82 YRI). We used the 35 technical replicates (1 CEU, 1 FIN, 1 GBR, 1 TSI, and 1 YRI sequenced at seven facilities) for the rRF correlations.

Other datasets: Gene Expression Omnibus and The Cancer Genome Atlas

We analyzed short RNA-seq for six samples from the Gene Expression Omnibus (GEO) data (GSE99430) [34] which looked at the 293T cells and their derived extracellular vesicles (EV). 293T cell samples are as follows: SRR5628228, SRR5628229, and SRR5628230. The EV samples are as follows: SRR5628231, SRR5628232, and SRR5628233. The abundances of the rRFs found in these datasets can be found in Additional file 4. We also analyzed short RNA-seq data for the 80 uveal melanoma (UVM) samples from The Cancer Genome Atlas (TCGA) [33].

Reference rRNAs

We used the GenBank 45S (RNA45SN1), 5S (RNA5S12), 12S (MT-RNR1), and 16S (MT-RNR2) rRNAs as our reference rRNA sequences for this analysis. The GenBank accession numbers are as follows: NR_145819.1, NR_023374.1, NR_137294.1, and NR_137295.1, respectively. RNA45SN1 was chosen as a representative 45S and is 13,351 nucleotides (nts) long. RNA5S12 was chosen as a representative 5S rRNA and is 121 nts long. MT-RNR1 and MT-RNR2 are the two consensus MT rRNAs and are 954 and 1,559 nts long, respectively.

Defining the “rRNA space”

We define “rRNA space” as the union of (a) the genomic regions that comprise the six rRNAs (see previous paragraph), (b) all rRNA repeats that are listed in RepeatMasker [59] including partial instances, and (c) any tambahan genomic regions that are identified via a glsearch [60] search of the genome using the six rRNAs as queries, default parameters, and an E value cutoff of 1E−08. An rRF that can be found in the union of the genomic regions obtained through steps a, b, and c above as well as elsewhere in the genome is referred to as an “ambiguous” rRF. Otherwise, it is referred to as being “exclusive” to the rRNA space. This is analogous to our definition of tRNA space and our analyses of tRFs [26, 30, 36, 48].

Pemetaan

We first processed the 434 short RNA-seq datasets using cutadapt [61] to quality-trim and remove adapters from the sequenced reads. The reads were then mapped to the genome using a brute-force, deterministic, and exhaustive approach that enforced exact matching to the genome. Only reads with a minimum of 16 nts were kept and analyzed further. During mapping, we catalogued reads which are exclusive to the rRNA space and which are ambiguous. We also kept track of reads that straddle either the left or the right boundary of any of the six rRNAs (Fig. 1a blue box).

Thresholding

We thresholded the rRFs using the Threshold-seq tool [35] and default parameter settings. Threshold-seq calculates an adaptive sequence read cutoff that is different for each sample (Fig. 1a green box). We also calculated a ≥ 10 RPM threshold by first normalizing each rRF’s abundance to reads-per-million (RPM) by dividing the number of reads that support the rRF by the total number of sequenced short RNA reads (i.e., read depth) and multiplying by 1 million then keeping only unique rRFs that passed a threshold of ≥ 10 RPM. (Fig. 1a orange box).

Determining length cutoffs

As might be expected, shorter sequences are more likely than longer sequences to have many genomic instances that are not part of the rRNA space. In fact, we find that many of the identified rRFs with lengths ≥ 16 nts are ambiguous. Thus, for each rRNA in turn, we identified the minimum length at which fewer than 2% of the genomic instances of an rRNA’s rRFs fall outside of the rRNA space. To do this, we first examined rRFs from the same rRNA if and only if their sequence lengths ranged from 16 through 33 nts inclusive. Next, for each rRF, we counted the number of its instances that fall inside the rRNA space, outside the rRNA space, and across the whole genome. For all rRFs from a given rRNA, and for each sequence length value (16–33 nts), we calculated the ratio of the number of instances that fall inside of the rRNA space over the total number of rRFs that fall outside of the rRNA space and call this the signal to noise ratio (S/N). We identified the minimum rRF length for which the S/N becomes ≥ 50 (the number of instances that fall outside of the rRNA space over the total number of genomic instances is ≤ 2%). We repeated this calculation separately for each of the six rRNAs (Fig. 1a red box).

Analisis

Differential abundances were calculated using the Significance Analysis of Microarrays (SAM) package in R using a stringent false discovery rate (FDR) cutoff of 0.01. Partial least squares-discriminant analysis (PLS-DA) was carried out in R using the default settings and a VIP cutoff of 1.5. Pearson correlations were calculated using R.

Isolasi RNA

For total RNA preparation, cells were grown in suspension using RPMI 1640 media with 30% non-heat inactivated FBS + glutamate (Sigma-Aldrich). After seeding, cells were grown for 3–5 days and harvested. RNA was isolated using TRIzol extraction (Invitrogen).

Northern blotting

We purchased commercially available lymphoblastoid cell lines (Coriell Institute) derived from 18 total people from the CEU, GBR, and YRI populations. For each population, we purchased three male samples and three female samples. The cell lines are the following: CEU females (GM12769, GM12807, GM12837) CEU males (GM12884, GM12905, GM12919), YRI females (GM18487, GM18523, GM18870), YRI males (GM18907, GM19203, GM19239), GBR females (HG00122, HG00134, HG00137), and GBR males (HG00243, HG00264, HG01789). As per Coriell’s policy, all cell lines were tested and found to be mycoplasma-free. 5μg of RNA from each cell line was run on a 15% acrylamide/8 M urea gel at 250 V for 45 min. 100 nmol of RNA target cDNA (5.8S 24-mer, GGGCTACGCCTGTCTGAGCGTCGC 5.8S 21-mer, TACGCCTGTCTGAGCGTCGCT 5S 18-mer, ACCGGGTGCTGTAGGCTT 28S 20-mer, CGCGACCTCAGATCAGACGT) served as positive control. Gel was transferred to Hybond™-N + membrane (Amersham Biosciences, catalog number: RPN303B) and transferred at 400 mA for 10 min. Membrane was dried and then cross-linked twice at 120,000 μJ/cm 2 . All membranes were cut so that the top portion could be probed with the 5S rRNA probe (ACGTCTGATCTGAGGTCGCGT)—the loading control, and the bottom portion was probed with the 5.8S 24-mer (GCGACGCTCAGACAGGCGTAGCCC), 5.8S 21-mer (AGCGACGCTCAGACAGGCGTA), 5S 18-mer (ACCGGGTGCTGTAGGCTT), and 28S 20-mer (ACGTCTGATCTGAGGTCGCG). Membranes were pre-hybridized in hybridization buffer (PerfectHyb™ Plus Hybridization Buffer: H7033-1 L) for 30 min rotating at 37 °C. Northern probes were made using the DIG labeling kit (DIG Oligonucleotide 3′-End Labeling Kit, 2nd Gen: 3353575910). For Fig. 5, the 9 LCL female and 9 LCL male RNAs were run on two different gels and the top portions of each membranes were incubated with 2.5 μl of 5S probe and the lower portions of the membranes were incubated with 5 μl of 5.8S 24-mer probe for 16 h rotating at 37 °C. For Additional file 6: Figure S5, female CEU (GM12769), GBR (HG0112), and YRI (GBM18523) RNA was used and uncut membranes were incubated with 5 μl of the corresponding probes. Detection of membranes was done using the DIG detection kit (DIG Wash and Block Buffer Set: 11585762001, Anti-Digoxigenin-AP, Fab fragments: 11093274910, CDP-Star Chemiluminescent Substrate: C0712-100ML) following the manufacturer’s instructions.

Secondary structures

Secondary structures were generated using the Vienna RNAFold Web Server http://rna.tbi.univie.ac.at/cgi-bin/RNAWebSuite/RNAfold.cgi [62] with default settings. The sequences for which we predicted secondary structures are listed in the “Reference rRNAs” section.

Deep sequencing of independently obtained commercial cell lines

We purchased commercially available lymphoblastoid cell lines (Coriell Institute) derived from two individuals: one who was a 63-year-old African American male (ND02672) and one who was a 66-year-old Caucasian American male (ND07114). As per Coriell’s policy, all cell lines were tested and found to be mycoplasma-free. Two different libraries were created for each sample: Illumina’s TruSeq Small RNA Library Prep Kit Set (#RS-200) and NEB’s NEBNext Small RNA Prep Set for Illumina (#E7330) at the Jefferson Genomics Core Facility according to the standard kit protocols, which size select for small RNAs. The Illumina NextSeq 3′-adapter is TGGAATTCTCGGGTGCCAAGG, and the NEBNext 3′-adapter is AGATCGGAAGAGCACACGTCT. The samples were all sequenced using the Illumina NextSeq 500 sequencing platform at 75 cycles and 30 million reads.


Tonton videonya: Emiliana Weiss - Revealing variation in ribosomal RNA gene repeats (Februari 2023).